HAGH (NM_001286249) Human Untagged Clone

CAT#: SC334693

HAGH (untagged) - Human hydroxyacylglutathione hydrolase (HAGH), transcript variant 3



  "NM_001286249" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-HAGH Antibody
    • 50 ug

CNY 5,200.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GLO2; GLX2; GLXII; HAGH1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>NCBI ORF sequence for NM_001286249, the custom clone sequence may differ by one or more nucleotides


ATGGTGGTGGGCCGAGGGCTGCTCGGCCGCCGCAGCCTCGCCGCGCTGGGAGCCGCCTGCGCCCGCCGAG
GCCTCGGTCCAGCCCTGCTGGGAGTTTTCTGCCACACAGATTTGCGGAAGAACCTGACCGTGGACGAGGG
CACCATGAAGGTAGAGGTGCTGCCTGCCCTGACCGACAACTACATGTACCTGGTCATTGATGATGAGACC
AAGGAGGCTGCCATTGTGGATCCGGTGCAGCCCCAGAAGGTCGTGGACGCGGCGAGAAAGCACGGGGTGA
AACTGACCACAGTGCTCACCACCCACCACCACTGGGACCATGCTGGCGGGAATGAGAAACTGGTCAAGCT
GGAGTCGGGACTGAAGGTGTACGGGGGTGACGACCGTATCGGGGCCCTGACTCACAAGATCACTCACCTG
TCCACACTGCAGGTGACACCTTGTTTGTGGCTGGCTGCGGGAAGTTCTATGAAGGGACTGCGGATGAGAT
GTGTAAAGCTCTGCTGGAGGTCTTGGGCCGGCTCCCCCCGGACACAAGAGTCTACTGTGGCCACGAGTAC
ACCATCAACAACCTCAAGTTTGCACGCCACGTGGAGCCCGGCAATGCCGCCATCCGGGAGAAGCTGGCCT
GGGCCAAGGAGAAGTACAGCATCGGGGAGCCCACAGTGCCATCCACCCTGGCAGAGGAGTTTACCTACAA
CCCCTTCATGA


Restriction Sites SgfI-MluI     
ACCN NM_001286249
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001286249.1, NP_001273178.1
RefSeq Size 1443 bp
RefSeq ORF 711 bp
Locus ID 3029
UniProt ID Q16775
Protein Families Druggable Genome
Protein Pathways Pyruvate metabolism
Gene Summary The enzyme encoded by this gene is classified as a thiolesterase and is responsible for the hydrolysis of S-lactoyl-glutathione to reduced glutathione and D-lactate. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2013]
Transcript Variant: This variant (3) lacks an alternate coding exon compared to variant 1, that causes a frameshift. The resulting isoform (3) has a shorter and distinct C-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...