C1orf86 (FAAP20) (NM_001282671) Human Untagged Clone

CAT#: SC333951

C1orf86 (untagged) - Human chromosome 1 open reading frame 86 (C1orf86), transcript variant 7



  "NM_001282671" in other vectors (2)

CNY 2,950.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-C1orf86 Antibody
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C1orf86; FP7162
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC333951 representing NM_001282671.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGGCCTGGGGTCTCTGCGCCTGGCCAAGAGGGCTGCGTGGCAATTTCCACACCTGTGCACCAGGC
CTCACTCAGAGGCATGAGGTGGCGCGACCCCCTCTCCCAGGGAGCTCAGAAGACGGCTCTGCCACACCT
GACACCTGGCAGCTGGCAGCCCTGCCTCTAGGAAGCCTCAGCTCTGGACAGCTGTGCCTTCACCTGAGG
GGTACTTCAACTCCCGCCCCCACCTGTGTCCCGCTGGCTCCTAAGCTGCCCCCCTACGTGTGGGTTGCG
TCTGAGATGTGGGGCAGGCGCCACTCACGGAAAAAAGGCATCAGAGGAGCTTCCACATCATCGGAACAT
TTTATTCCTCAGGACGCTACACGCTCACTTTCCTGGCGGAGCAGGTCAGTGCATCGAGTTCTGTTTCCG
TGGAAAATGTGCACCTTGGAAACCGCATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001282671
Insert Size 444 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001282671.1
RefSeq Size 2382 bp
RefSeq ORF 444 bp
Locus ID 199990
UniProt ID Q6NZ36
MW 16.2 kDa
Gene Summary Component of the Fanconi anemia (FA) complex required to recruit the FA complex to DNA interstrand cross-links (ICLs) and promote ICLs repair. Following DNA damage recognizes and binds 'Lys-63'-linked ubiquitin generated by RNF8 at ICLs and recruits other components of the FA complex. Promotes translesion synthesis via interaction with REV1.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (7) uses alternate exon structure in its 3' region, compared to variant 2. The encoded isoform (7) is distinct and shorter, compared to isoform 2, but it shares regions in common with isoforms 1 and 3. Both variants 7 and 8 encode the same isoform (7). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...