Factor VII (F7) (NM_001267554) Human Untagged Clone
CAT#: SC332851
F7 (untagged) - Homo sapiens coagulation factor VII (serum prothrombin conversion accelerator) (F7), transcript variant 3
CNY 3,610.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | SPCA |
Vector | pCMV6-Entry |
Sequence Data |
>SC332851 representing NM_001267554.
Blue=Insert sequence Red=Cloning site Green=Tag(s) ATGGTCTCCCAGGCCCTCAGGCTCCTCTGCCTTCTGCTTGGGCTTCAGGGCTGCCTGGCTGCAGATGGG GACCAGTGTGCCTCAAGTCCATGCCAGAATGGGGGCTCCTGCAAGGACCAGCTCCAGTCCTATATCTGC TTCTGCCTCCCTGCCTTCGAGGGCCGGAACTGTGAGACGCACAAGGATGACCAGCTGATCTGTGTGAAC GAGAACGGCGGCTGTGAGCAGTACTGCAGTGACCACACGGGCACCAAGCGCTCCTGTCGGTGCCACGAG GGGTACTCTCTGCTGGCAGACGGGGTGTCCTGCACACCCACAGTTGAATATCCATGTGGAAAAATACCT ATTCTAGAAAAAAGAAATGCCAGCAAACCCCAAGGCCGAATTGTGGGGGGCAAGGTGTGCCCCAAAGGG GAGTGTCCATGGCAGGTCCTGTTGTTGGTGAATGGAGCTCAGTTGTGTGGGGGGACCCTGATCAACACC ATCTGGGTGGTCTCCGCGGCCCACTGTTTCGACAAAATCAAGAACTGGAGGAACCTGATCGCGGTGCTG GGCGAGCACGACCTCAGCGAGCACGACGGGGATGAGCAGAGCCGGCGGGTGGCGCAGGTCATCATCCCC AGCACGTACGTCCCGGGCACCACCAACCACGACATCGCGCTGCTCCGCCTGCACCAGCCCGTGGTCCTC ACTGACCATGTGGTGCCCCTCTGCCTGCCCGAACGGACGTTCTCTGAGAGGACGCTGGCCTTCGTGCGC TTCTCATTGGTCAGCGGCTGGGGCCAGCTGCTGGACCGTGGCGCCACGGCCCTGGAGCTCATGGTCCTC AACGTGCCCCGGCTGATGACCCAGGACTGCCTGCAGCAGTCACGGAAGGTGGGAGACTCCCCAAATATC ACGGAGTACATGTTCTGTGCCGGCTACTCGGATGGCAGCAAGGACTCCTGCAAGGGGGACAGTGGAGGC CCACATGCCACCCACTACCGGGGCACGTGGTACCTGACGGGCATCGTCAGCTGGGGCCAGGGCTGCGCA ACCGTGGGCCACTTTGGGGTGTACACCAGGGTCTCCCAGTACATCGAGTGGCTGCAAAAGCTCATGCGC TCAGAGCCACGCCCAGGAGTCCTCCTGCGAGCCCCATTTCCCTAG |
Restriction Sites | SgfI-MluI |
ACCN | NM_001267554 |
Insert Size | 1149 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001267554.1 |
RefSeq Size | 2892 bp |
RefSeq ORF | 1149 bp |
Locus ID | 2155 |
Protein Families | Druggable Genome, Protease |
Protein Pathways | Complement and coagulation cascades |
MW | 41.9 kDa |
Gene Summary | This gene encodes coagulation factor VII which is a vitamin K-dependent factor essential for hemostasis. This factor circulates in the blood in a zymogen form, and is converted to an active form by either factor IXa, factor Xa, factor XIIa, or thrombin by minor proteolysis. Upon activation of the factor VII, a heavy chain containing a catalytic domain and a light chain containing 2 EGF-like domains are generated, and two chains are held together by a disulfide bond. In the presence of factor III and calcium ions, the activated factor then further activates the coagulation cascade by converting factor IX to factor IXa and/or factor X to factor Xa. Defects in this gene can cause coagulopathy. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing to generate mature polypeptides. [provided by RefSeq, Aug 2015] Transcript Variant: This variant (3) lacks three consecutive exons in the 5' coding region, but maintains the reading frame, compared to variant 1. The encoded isoform (c) is shorter than isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. A downstream translational start codon is selected for this RefSeq based on its better conservation in mammalian species. An upstream in-frame start codon is also present and would result in a protein that is 15 aa longer at the N-terminus, but this start codon is poorly conserved and located within a protein-binding site identified in the promoter region, as described in PubMed: 8576177. Leaky scanning by ribosomes may allow translation initiation at the downstream start codon. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC233936 | F7 (Myc-DDK tagged) - Homo sapiens coagulation factor VII (serum prothrombin conversion accelerator) (F7), transcript variant 3 |
CNY 3,990.00 |
|
RG233936 | F7 (tGFP-tagged) - Homo sapiens coagulation factor VII (serum prothrombin conversion accelerator) (F7), transcript variant 3 |
CNY 4,370.00 |
其它Factor VII产品