WDR4 (NM_001260474) Human Untagged Clone

CAT#: SC332727

WDR4 (untagged) - Homo sapiens WD repeat domain 4 (WDR4), transcript variant 3



  "NM_001260474" in other vectors (2)

CNY 3,900.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
WDR4 mouse monoclonal antibody, clone OTI4G1 (formerly 4G1)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GAMOS6; hWH; MIGSB; TRM82; TRMT82; Wuho
Vector pCMV6-Entry
Sequence Data
>SC332727 representing NM_001260474.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGGCGGGCTCTGTGGGACTGGCGTTGTGCGGGCAGACGTTGGTGGTGCGGGGCGGCAGCCGATTCCTG
GCCACCTCCATAGCAAGCAGTGATGATGACAGCCTCTTCATCTATGACTGCAGTGCTGCAGAAAAGAAG
TCACAAGAAAATAAAGGGGAGGACGCGCCCTTGGACCAGGGGAGCGGTGCGATTCTGGCGTCCACCTTC
TCCAAGTCTGGCAGCTATTTTGCTTTAACCGATGACAGTAAGCGTCTGATTCTTTTCCGTACAAAACCA
TGGCAATGTCTGAGTGTCAGGACCGTGGCAAGGAGGTGTACAGCCCTGACTTTCATAGCCTCGGAGGAG
AAGGTCTTGGTGGCCGACAAGTCTGGAGACGTCTACTCCTTTTCGGTGCTGGAGCCACACGGGTGTGGC
CGTCTAGAGCTGGGGCACCTGTCTATGCTGTTAGATGTGGCTGTGAGTCCTGATGACCGCTTCATCCTC
ACTGCCGACCGGGACGAGAAGATCCGAGTCAGCTGGGCCGCGGCGCCCCATAGCATCGAGTCCTTCTGC
TTGGGGCACACAGAGTTTGTGAGCCGTATCTCCGTGGTGCCAACTCAGCCCGGGCTGCTTCTGTCCTCC
TCTGGGGACGGCACCCTGAGGCTCTGGGAGTACAGGAGCGGCCGCCAGCTGCACTGCTGTCACCTGGCC
AGTCTGCAGGAGCTGGTGGACCCCCAGGCCCCCCAGTTTGCCGCGTCCAGGATTGCATTCTGGTGCCAG
GAGAACTGCGTGGCGCTCCTGTGCGACGGCACTCCTGTGGTCTACATCTTCCAGCTGGACGCCCGCAGA
CAGCAGTTGGTGTACAGGCAGCAGCTGGCGTTCCAGCACCAAGTGTGGGACGTGGCTTTCGAGGAGACC
CAGGGGCTGTGGGTGCTCCAGGACTGCCAGGAAGCCCCCCTGGTGCTCTACAGGCCTGTGGGCGACCAG
TGGCAGTCTGTTCCTGAGAGCACCGTGTTAAAGAAAGTCTCTGGTGTTCTTCGTGGGAACTGGGCCATG
CTGGAAGGCTCTGCCGGCGCAGACGCCAGCTTCAGCAGTCTCTACAAGGCCACGTTCGACAACGTGACC
TCCTACCTGAAGAAGAAAGAGGAGAGACTGCAGCAGCAGCTAGAGAAGAAGCAGCGGCGCCGGAGTCCC
CCGCCTGGGCCCGACGGGCATGCCAAGAAGATGAGACCGGGGGAGGCGACGCTAAGTTGCTGA

Restriction Sites SgfI-MluI     
ACCN NM_001260474
Insert Size 1236 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001260474.1
RefSeq Size 2165 bp
RefSeq ORF 1236 bp
Locus ID 10785
UniProt ID P57081
MW 45.4 kDa
Gene Summary This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. This gene is excluded as a candidate for a form of nonsyndromic deafness (DFNB10), but is still a candidate for other disorders mapped to 21q22.3 as well as for the development of Down syndrome phenotypes. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]
Transcript Variant: This variant (3) uses an alternate in-frame acceptor splice site at an internal coding exon compared to variant 1, resulting in a shorter isoform (2) missing a single aa compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...