DGAT2 (NM_001253891) Human Untagged Clone

CAT#: SC330315

DGAT2 (untagged) - Homo sapiens diacylglycerol O-acyltransferase 2 (DGAT2), transcript variant 2



  "NM_001253891" in other vectors (2)

CNY 3,330.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Goat Anti-DGAT2 Antibody
    • 100 ug

CNY 5,371.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARAT; GS1999FULL; HMFN1045
Vector pCMV6-Entry
Sequence Data
>SC330315 representing NM_001253891.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGAAGACCCTCATAGCCGCCTACTCCGGGGTCCTGCGCGGCGAGCGTCAGGCCGAGGCTGACCGGAGC
CAGCGCTCTCACGGAGGACCTGCGCTGTCGCGCGAGGGGTCTGGGAGATGGGGAGTGGCCTGCAGTGCC
ATCCTCATGTACATATTCTGCACTGATTGCTGGCTCATCGCTGTGCTCTACTTCACTTGGCTGGTGTTT
GACTGGAACACACCCAAGAAAGGTGGCAGGAGGTCACAGTGGGTCCGAAACTGGGCTGTGTGGCGCTAC
TTTCGAGACTACTTTCCCATCCAGCTGGTGAAGACACACAACCTGCTGACCACCAGGAACTATATCTTT
GGATACCACCCCCATGGTATCATGGGCCTGGGTGCCTTCTGCAACTTCAGCACAGAGGCCACAGAAGTG
AGCAAGAAGTTCCCAGGCATACGGCCTTACCTGGCTACACTGGCAGGCAACTTCCGAATGCCTGTGTTG
AGGGAGTACCTGATGTCTGGAGGTATCTGCCCTGTCAGCCGGGACACCATAGACTATTTGCTTTCAAAG
AATGGGAGTGGCAATGCTATCATCATCGTGGTCGGGGGTGCGGCTGAGTCTCTGAGCTCCATGCCTGGC
AAGAATGCAGTCACCCTGCGGAACCGCAAGGGCTTTGTGAAACTGGCCCTGCGTCATGGAGCTGACCTG
GTTCCCATCTACTCCTTTGGAGAGAATGAAGTGTACAAGCAGGTGATCTTCGAGGAGGGCTCCTGGGGC
CGATGGGTCCAGAAGAAGTTCCAGAAATACATTGGTTTCGCCCCATGCATCTTCCATGGTCGAGGCCTC
TTCTCCTCCGACACCTGGGGGCTGGTGCCCTACTCCAAGCCCATCACCACTGTTGTGGGAGAGCCCATC
ACCATCCCCAAGCTGGAGCACCCAACCCAGCAAGACATCGACCTGTACCACACCATGTACATGGAGGCC
CTGGTGAAGCTCTTCGACAAGCACAAGACCAAGTTCGGCCTCCCGGAGACTGAGGTCCTGGAGGTGAAC
TGA

Restriction Sites SgfI-MluI     
ACCN NM_001253891
Insert Size 1038 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001253891.1
RefSeq Size 2336 bp
RefSeq ORF 1038 bp
Locus ID 84649
UniProt ID Q96PD7
Protein Families Transmembrane
Protein Pathways Glycerolipid metabolism, Metabolic pathways, Retinol metabolism
MW 39 kDa
Gene Summary This gene encodes one of two enzymes which catalyzes the final reaction in the synthesis of triglycerides in which diacylglycerol is covalently bound to long chain fatty acyl-CoAs. The encoded protein catalyzes this reaction at low concentrations of magnesium chloride while the other enzyme has high activity at high concentrations of magnesium chloride. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting protein (isoform 2) is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...