Non Neuronal Enolase (ENO1) (NM_001201483) Human Untagged Clone
CAT#: SC329628
ENO1 (untagged) - Homo sapiens enolase 1, (alpha) (ENO1), transcript variant 2
CNY 5,856.00
货期*
现货
规格
Product images
经常一起买 (3)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ENO1L1; HEL-S-17; MPB1; NNE; PPH |
Vector | PCMV6-Neo |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_001201483, the custom clone sequence may differ by one or more nucleotides
ATGATCGAGATGGATGGAACAGAAAATAAATCTAAGTTTGGTGCGAACGCCATTCTGGGGGTGTCCCTTG CCGTCTGCAAAGCTGGTGCCGTTGAGAAGGGGGTCCCCCTGTACCGCCACATCGCTGACTTGGCTGGCAA CTCTGAAGTCATCCTGCCAGTCCCGGCGTTCAATGTCATCAATGGCGGTTCTCATGCTGGCAACAAGCTG GCCATGCAGGAGTTCATGATCCTCCCAGTCGGTGCAGCAAACTTCAGGGAAGCCATGCGCATTGGAGCAG AGGTTTACCACAACCTGAAGAATGTCATCAAGGAGAAATATGGGAAAGATGCCACCAATGTGGGGGATGA AGGCGGGTTTGCTCCCAACATCCTGGAGAATAAAGAAGGCCTGGAGCTGCTGAAGACTGCTATTGGGAAA GCTGGCTACACTGATAAGGTGGTCATCGGCATGGACGTAGCGGCCTCCGAGTTCTTCAGGTCTGGGAAGT ATGACCTGGACTTCAAGTCTCCCGATGACCCCAGCAGGTACATCTCGCCTGACCAGCTGGCTGACCTGTA CAAGTCCTTCATCAAGGACTACCCAGTGGTGTCTATCGAAGATCCCTTTGACCAGGATGACTGGGGAGCT TGGCAGAAGTTCACAGCCAGTGCAGGAATCCAGGTAGTGGGGGATGATCTCACAGTGACCAACCCAAAGA GGATCGCCAAGGCCGTGAACGAGAAGTCCTGCAACTGCCTCCTGCTCAAAGTCAACCAGATTGGCTCCGT GACCGAGTCTCTTCAGGCGTGCAAGCTGGCCCAGGCCAATGGTTGGGGCGTCATGGTGTCTCATCGTTCG GGGGAGACTGAAGATACCTTCATCGCTGACCTGGTTGTGGGGCTGTGCACTGGGCAGATCAAGACTGGTG CCCCTTGCCGATCTGAGCGCTTGGCCAAGTACAACCAGCTCCTCAGAATTGAAGAGGAGCTGGGCAGCAA GGCTAAGTTTGCCGGCAGGAACTTCAGAAACCCCTTGGCCAAGTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_001201483 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001201483.1, NP_001188412.1 |
RefSeq Size | 2567 bp |
RefSeq ORF | 1026 bp |
Locus ID | 2023 |
UniProt ID | P06733 |
Protein Families | Druggable Genome, Transcription Factors |
Protein Pathways | Glycolysis / Gluconeogenesis, Metabolic pathways, RNA degradation |
Gene Summary | This gene encodes alpha-enolase, one of three enolase isoenzymes found in mammals. Each isoenzyme is a homodimer composed of 2 alpha, 2 gamma, or 2 beta subunits, and functions as a glycolytic enzyme. Alpha-enolase in addition, functions as a structural lens protein (tau-crystallin) in the monomeric form. Alternative splicing of this gene results in a shorter isoform that has been shown to bind to the c-myc promoter and function as a tumor suppressor. Several pseudogenes have been identified, including one on the long arm of chromosome 1. Alpha-enolase has also been identified as an autoantigen in Hashimoto encephalopathy. [provided by RefSeq, Jan 2011] Transcript Variant: This variant (2) differs at the 5' end compared to variant 1, and initiates translation from a downstream in-frame start codon, resulting in a shorter isoform (MBP-1). This isoform is localized to the nucleus, and functions as a transcriptional repressor of c-myc protooncogene by binding to its promoter (PMID:20849415). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
其它Non Neuronal Enolase产品
Customer
Reviews
Loading...