GABPA (NM_001197297) Human Untagged Clone

CAT#: SC329464

GABPA (untagged) - Homo sapiens GA binding protein transcription factor, alpha subunit 60kDa (GABPA), transcript variant 2



  "NM_001197297" in other vectors (2)

CNY 4,370.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
GABPA Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms E4TF1-60; E4TF1A; NFT2; NRF2; NRF2A; RCH04A07
Vector pCMV6-Entry
Sequence Data
>SC329464 representing NM_001197297.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

ATGACTAAAAGAGAAGCAGAGGAGCTGATAGAAATTGAGATTGATGGAACAGAGAAAGCAGAGTGCACA
GAAGAAAGCATTGTAGAACAAACCTACGCGCCAGCTGAATGTGTAAGCCAGGCCATAGACATCAATGAA
CCAATAGGCAATTTAAAGAAACTGCTAGAACCAAGACTACAGTGTTCTTTGGATGCTCATGAAATTTGT
CTGCAAGATATCCAGCTGGATCCAGAACGAAGTTTATTTGACCAAGGAGTAAAAACAGATGGAACTGTA
CAGCTTAGTGTACAGGTAATTTCTTACCAAGGAATTGAACCAAAGTTAAACATCCTTGAAATTGTTAAA
CCTGCGGACACTGTTGAGGTTGTTATTGATCCAGATGCCCACCATGCTGAATCAGAAGCACATCTTGTT
GAAGAAGCTCAAGTGATAACTCTTGATGGCACAAAACACATCACAACCATTTCAGATGAAACTTCAGAA
CAAGTGACAAGATGGGCTGCTGCACTGGAAGGCTATAGGAAAGAACAAGAACGCCTTGGGATACCCTAT
GATCCCATACAGTGGTCCACAGACCAAGTCCTGCATTGGGTGGTTTGGGTAATGAAGGAATTCAGCATG
ACCGATATAGACCTCACCACACTCAACATTTCGGGGAGAGAATTATGTAGTCTCAACCAAGAAGATTTT
TTTCAGCGGGTTCCTCGGGGAGAAATTCTCTGGAGTCATCTGGAACTTCTCCGAAAATATGTATTGGCA
AGTCAAGAACAACAGATGAATGAAATAGTTACAATTGATCAACCTGTGCAAATTATTCCAGCATCAGTG
CAATCTGCTACACCTACTACCATTAAAGTTATAAATAGTAGTGCGAAAGCAGCCAAAGTACAAAGAGCG
CCGAGGATTTCAGGAGAAGATAGAAGCTCACCTGGGAACAGAACAGGAAACAATGGCCAAATCCAACTA
TGGCAGTTTTTGCTAGAACTTCTTACTGATAAGGACGCTCGAGACTGCATTTCTTGGGTTGGTGATGAA
GGTGAATTTAAGCTAAATCAGCCTGAACTGGTTGCACAGAAATGGGGACAGCGTAAAAATAAGCCTACG
ATGAACTATGAGAAACTCAGTCGTGCATTAAGATATTATTACGATGGGGACATGATTTGTAAAGTTCAA
GGCAAGAGATTTGTGTACAAGTTTGTCTGTGACTTGAAGACTCTTATTGGATACAGTGCAGCGGAGTTG
AACCGTTTGGTCACAGAATGTGAACAGAAGAAACTTGCAAAGATGCAGCTCCATGGAATTGCCCAGCCA
GTCACAGCAGTAGCTCTGGCTACTGCTTCTCTGCAAACGGAAAAGGATAATTGA

Restriction Sites SgfI-MluI     
ACCN NM_001197297
Insert Size 1365 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001197297.1
RefSeq Size 4745 bp
RefSeq ORF 1365 bp
Locus ID 2551
UniProt ID Q06546
Protein Families Transcription Factors
MW 51.3 kDa
Gene Summary This gene encodes one of three GA-binding protein transcription factor subunits which functions as a DNA-binding subunit. Since this subunit shares identity with a subunit encoding the nuclear respiratory factor 2 gene, it is likely involved in activation of cytochrome oxidase expression and nuclear control of mitochondrial function. This subunit also shares identity with a subunit constituting the transcription factor E4TF1, responsible for expression of the adenovirus E4 gene. Because of its chromosomal localization and ability to form heterodimers with other polypeptides, this gene may play a role in the Down Syndrome phenotype. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Oct 2010]
Transcript Variant: This variant differs in the 5' UTR compared to variant 1. Variants 1 and 2 both encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...