Porimin (TMEM123) (NM_052932) Human Untagged Clone

CAT#: SC317311

TMEM123 (untagged)-Human transmembrane protein 123 (TMEM123)



  "NM_052932" in other vectors (7)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-TMEM123 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms KCT3; PORIMIN; PORMIN
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC317311 representing NM_052932.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGACTCGGCGCGCGAGGTGCTTGGGCCGCGCTGCTCCTGGGGACGCTGCAGGTGCTAGCGCTGCTG
GGGGCCGCCCATGAAAGCGCAGCCATGGCGGCATCTGCAAACATAGAGAATTCTGGGCTTCCACACAAC
TCCAGTGCTAACTCAACAGAGACTCTCCAACATGTGCCTTCTGACCATACAAATGAAACTTCCAACAGT
ACTGTGAAACCACCAACTTCAGTTGCCTCAGACTCCAGTAATACAACGGTCACCACCATGAAACCTACA
GCGGCATCTAATACAACAACACCAGGGATGGTCTCAACAAATATGACTTCTACCACCTTAAAGTCTACA
CCCAAAACAACAAGTGTTTCACAGAACACATCTCAGATATCAACATCCACAATGACCGTAACCCACAAT
AGTTCAGTGACATCTGCTGCTTCATCAGTAACAATCACAACAACTATGCATTCTGAAGCAAAGAAAGGA
TCAAAATTTGATACTGGGAGCTTTGTTGGTGGTATTGTATTAACGCTGGGAGTTTTATCTATTCTTTAC
ATTGGATGCAAAATGTATTACTCAAGAAGAGGCATTCGGTATCGAACCATAGATGAACATGATGCCATC
ATTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_052932
Insert Size 627 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_052932.2
RefSeq Size 3605 bp
RefSeq ORF 627 bp
Locus ID 114908
UniProt ID Q8N131
Protein Families Transmembrane
MW 21.5 kDa
Gene Summary This gene encodes a highly glycosylated transmembrane protein with a high content of threonine and serine residues in its extracellular domain, similar to a broadly defined category of proteins termed mucins. Exposure of some cell types to anti-PORIMIN (pro-oncosis receptor inducing membrane injury) antibody, crosslinks this protein on the cell surface and induces a type of cell death termed oncosis. Oncosis is distinct from apoptosis and is characterized by a loss of cell membrane integrity without DNA fragmentation. This gene product is proposed to function as a cell surface receptor that mediates cell death. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...