OCIAD1 (NM_001079840) Human Untagged Clone
CAT#: SC315687
OCIAD1 (untagged)-Human OCIA domain containing 1 (OCIAD1), transcript variant 3
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ASRIJ; OCIA; TPA018 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001079840, the custom clone sequence may differ by one or more nucleotides
ATGAATGGGAGGGCTGATTTTCGAGAGCCGAATGCAGAGGTTCCAAGACCAATTCCCCAC ATAGGGCCTGATTACATTCCAACAGAGGAAGAAAGGAGAGTCTTCGCAGAATGCAATGAT GAAAGCTTCTGGTTCAGATCTGTGCCTTTGGCTGCAACAAGTATGTTGATTACTCAAGGA TTAATTAGTAAAGGAATACTTTCAAGTCATCCCAAATATGGTTCCATCCCTAAACTTATA CTTGCTTGTATCATGGGATACTTTGCTGGAAAACTTTCTTATGTGAAAACTTGCCAAGAG AAATTCAAGAAACTTGAAAATTCCCCCCTTGGAGAAGCTTTACGATCAGGACAAGCACGA CGATCTTCACCACCTGGGCACTATTATCAAAAGTCAAAATATGACTCAAGTGTGAGTGGT CAATCATCTTTTGTGACATCCCCAGCAGCAGACAACATAGAAATGCTTCCTCATTATGAG CCAATTCCATTCAGTTCTTCTATGAATGAATCTGCTCCCACTGGTATTACTGATCATATT GTCCAAGTCAAAGTAAACAAGTATGGAGATACTTGGGATGAG |
Restriction Sites | Please inquire |
ACCN | NM_001079840 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001079840.1, NP_001073309.1 |
RefSeq Size | 1906 bp |
RefSeq ORF | 585 bp |
Locus ID | 54940 |
UniProt ID | Q9NX40 |
Gene Summary | Maintains stem cell potency (By similarity). Increases STAT3 phosphorylation and controls ERK phosphorylation (By similarity). May act as a scaffold, increasing STAT3 recruitment onto endosomes (By similarity). Involved in integrin-mediated cancer cell adhesion and colony formation in ovarian cancer (PubMed:20515946).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) lacks an in-frame exon in the 3' coding region, compared to variant 1, resulting in an isoform (2) that is shorter than isoform 1. Both variants 3 and 5 encode the same isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216539 | OCIAD1 (Myc-DDK-tagged)-Human OCIA domain containing 1 (OCIAD1), transcript variant 3 |
CNY 3,990.00 |
|
RC216539L3 | Lenti-ORF clone of OCIAD1 (Myc-DDK-tagged)-Human OCIA domain containing 1 (OCIAD1), transcript variant 3 |
CNY 5,890.00 |
|
RC216539L4 | Lenti-ORF clone of OCIAD1 (mGFP-tagged)-Human OCIA domain containing 1 (OCIAD1), transcript variant 3 |
CNY 5,890.00 |
|
RG216539 | OCIAD1 (tGFP-tagged) - Human OCIA domain containing 1 (OCIAD1), transcript variant 3 |
CNY 4,370.00 |