THYN1 (NM_199297) Human Untagged Clone
CAT#: SC307927
THYN1 (untagged)-Human thymocyte nuclear protein 1 (THYN1), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HSPC144; MDS012; MY105; THY28; THY28KD |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC307927 representing NM_199297.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCGAGACCCCGGAAGAGGCTGGCTGGGACTTCTGGTTCAGACAAGGGACTATCAGGAAAACGCACC AAAACTGAGAACTCAGGTGAGGCATTAGCTAAAGTGGAGGACTCCAACCCTCAGAAGACTTCAGCCACT AAAAACTGTTTGAAGAATCTAAGCAGCCACTGGCTGATGAAGTCAGAGCCAGAGAGCCGCCTAGAGAAA GGTGTAGATGTGAAGTTCAGCATTGAGGATCTCAAAGCACAGCCCAAACAGACAACATGCTGGGATGGT GTTCGTAACTACCAGGCTCGGAACTTCCTTAGAGCCATGAAGCTGGGAGAAGAAGCCTTCTTCTACCAT AGCAACTGCAAAGAGCCAGGCATCGCAGGACTCATGAAGATCGTGAAAGAGGCTTACCCAGACCACACA CAGTTTGAGAAAAACAATCCCCATTATGACCCATCTAGCAAAGAGGACAACCCTAAGTGGTCCATGAAG AGTTTGATTTTGTTTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_199297 |
Insert Size | 501 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_199297.1 |
RefSeq Size | 862 bp |
RefSeq ORF | 501 bp |
Locus ID | 29087 |
UniProt ID | Q9P016 |
MW | 18.8 kDa |
Gene Summary | This gene encodes a protein that is highly conserved among vertebrates and plant species and may be involved in the induction of apoptosis. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 5' UTR and lacks an exon in the 3' coding region, compared to variant 1. The resulting isoform (2) has a distinct and shorter C-terminus, compared to isoform 1. Isoform 2 is also encoded by variant 4. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222714 | THYN1 (Myc-DDK-tagged)-Human thymocyte nuclear protein 1 (THYN1), transcript variant 2 |
CNY 1,200.00 |
|
RC222714L3 | Lenti ORF clone of Human thymocyte nuclear protein 1 (THYN1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC222714L4 | Lenti ORF clone of Human thymocyte nuclear protein 1 (THYN1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG222714 | THYN1 (tGFP-tagged) - Human thymocyte nuclear protein 1 (THYN1), transcript variant 2 |
CNY 4,370.00 |