Ghrelin Receptor (GHSR) (NM_198407) Human Untagged Clone

CAT#: SC307691

GHSR (untagged)-Human growth hormone secretagogue receptor (GHSR), transcript variant 1a



  "NM_198407" in other vectors (6)

CNY 3,656.00

CNY 7,220.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Ghrelin Receptor / GHSR Rabbit Polyclonal (N-Terminus) Antibody
    • 50 ug

CNY 5,654.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GHDP
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_198407 edited
ATGTGGAACGCGACGCCCAGCGAAGAGCCGGGGTTCAACCTCACACTGGCCGACCTGGAC
TGGGATGCTTCCCCCGGCAACGACTCGCTGGGCGACGAGCTGCTGCAGCTCTTCCCCGCG
CCGCTGCTGGCGGGCGTCACAGCCACCTGCGTGGCACTCTTCGTGGTGGGTATCGCTGGC
AACCTGCTCACCATGCTGGTGGTGTCGCGCTTCCGCGAGCTGCGCACCACCACCAACCTC
TACCTGTCCAGCATGGCCTTCTCCGATCTGCTCATCTTCCTCTGCATGCCCCTGGACCTC
GTTCGCCTCTGGCAGTACCGGCCCTGGAACTTCGGCGACCTCCTCTGCAAACTCTTCCAA
TTCGTCAGTGAGAGCTGCACCTACGCCACGGTGCTCACCATCACAGCGCTGAGCGTCGAG
CGCTACTTCGCCATCTGCTTCCCACTCCGGGCCAAGGTGGTGGTCACCAAGGGGCGGGTG
AAGCTGGTCATCTTCGTCATCTGGGCCGTGGCCTTCTGCAGCGCCGGGCCCATCTTCGTG
CTAGTCGGGGTGGAGCACGAGAACGGCACCGACCCTTGGGACACCAACGAGTGCCGCCCC
ACCGAGTTTGCGGTGCGCTCTGGACTGCTCACGGTCATGGTGTGGGTGTCCAGCATCTTC
TTCTTCCTTCCTGTCTTCTGTCTCACGGTCCTCTACAGTCTCATCGGCAGGAAGCTGTGG
CGGAGGAGGCGCGGCGATGCTGTCGTGGGTGCCTCGCTCAGGGACCAGAACCACAAGCAA
ACCGTGAAAATGCTGGCTGTAGTGGTGTTTGCCTTCATCCTCTGCTGGCTCCCCTTCCAC
GTAGGGCGATATTTATTTTCCAAATCCTTTGAGCCTGGCTCCTTGGAGATTGCTCAGATC
AGCCAGTACTGCAACCTCGTGTCCTTTGTCCTCTTCTACCTCAGTGCTGCCATCAACCCC
ATTCTGTACAACATCATGTCCAAGAAGTACCGGGTGGCAGTGTTCAGACTTCTGGGATTC
GAACCCTTCTCCCAGAGAAAGCTCTCCACTCTGAAAGATGAAAGTTCTCGGGCCTGGACA
GAATCTAGTATTAATACATGA
Restriction Sites Please inquire     
ACCN NM_198407
Insert Size 1100 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_198407.1, NP_940799.1
RefSeq Size 1101 bp
RefSeq ORF 1101 bp
Locus ID 2693
UniProt ID Q92847
Protein Families Druggable Genome, GPCR, Transmembrane
Protein Pathways Neuroactive ligand-receptor interaction
Gene Summary This gene encodes a member of the G-protein coupled receptor family. The encoded protein may play a role in energy homeostasis and regulation of body weight. Two identified transcript variants are expressed in several tissues and are evolutionary conserved in fish and swine. One transcript, 1a, excises an intron and encodes the functional protein; this protein is the receptor for the Ghrelin ligand and defines a neuroendocrine pathway for growth hormone release. The second transcript (1b) retains the intron and does not function as a receptor for Ghrelin; however, it may function to attenuate activity of isoform 1a. Mutations in this gene are associated with autosomal idiopathic short stature.[provided by RefSeq, Apr 2010]
Transcript Variant: This variant (1a), also known as GHS-R1a, represents the completely spliced transcript, and encodes the longer isoform (1a). This transcript has been shown to encode a functional protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...