EBAG9 (NM_198120) Human Untagged Clone
CAT#: SC307629
EBAG9 (untagged)-Human estrogen receptor binding site associated, antigen, 9 (EBAG9), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | EB9; PDAF |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC307629 representing NM_198120.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCCATCACCCAGTTTCGGTTATTTAAATTTTGTACCTGCCTAGCAACAGTATTCTCATTCCTAAAG AGATTAATATGCAGATCTGGCAGAGGACGGAAATTAAGTGGAGACCAAATAACTTTGCCAACTACAGTT GATTATTCATCAGTTCCTAAGCAGACAGATGTTGAAGAGTGGACTTCCTGGGATGAAGATGCACCCACC AGTGTAAAGATCGAAGGAGGGAATGGGAATGTGGCAACACAACAAAATTCTTTGGAACAACTGGAACCT GACTATTTTAAGGACATGACACCAACTATTAGGAAAACTCAGAAAATTGTTATTAAGAAGAGAGAACCA TTGAATTTTGGCATCCCAGATGGGAGCACAGGTTTCTCTAGTAGATTAGCAGCTACACAAGATCTGCCT TTTATTCATCAGTCTTCTGAATTAGGTGACTTAGATACCTGGCAGGAAAATACCAATGCATGGGAAGAA GAAGAAGATGCAGCCTGGCAAGCAGAAGAAGTTCTGAGACAGCAGAAACTAGCAGACAGAGAAAAGAGA GCAGCCGAACAACAAAGGAAGAAAATGGAAAAGGAAGCACAACGGCTAATGAAGAAGGAACAAAACAAA ATTGGTGTGAAACTTTCATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_198120 |
Insert Size | 642 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_198120.2 |
RefSeq Size | 2328 bp |
RefSeq ORF | 642 bp |
Locus ID | 9166 |
UniProt ID | O00559 |
Protein Families | Druggable Genome |
MW | 24.4 kDa |
Gene Summary | This gene was identified as an estrogen-responsive gene. Regulation of transcription by estrogen is mediated by estrogen receptor, which binds to the estrogen-responsive element found in the 5'-flanking region of this gene. The encoded protein is a tumor-associated antigen that is expressed at high frequency in a variety of cancers. Alternate splicing results in multiple transcript variants. A pseudogene of this gene has been defined on chromosome 10. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1, 2, and 3 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC215667 | EBAG9 (Myc-DDK-tagged)-Human estrogen receptor binding site associated, antigen, 9 (EBAG9), transcript variant 2 |
CNY 2,400.00 |
|
RC215667L3 | Lenti ORF clone of Human estrogen receptor binding site associated, antigen, 9 (EBAG9), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC215667L4 | Lenti ORF clone of Human estrogen receptor binding site associated, antigen, 9 (EBAG9), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG215667 | EBAG9 (tGFP-tagged) - Human estrogen receptor binding site associated, antigen, 9 (EBAG9), transcript variant 2 |
CNY 4,370.00 |