United States
Germany
Japan
United Kingdom
China
GSTA5 (NM_153699) Human Untagged Clone
CAT＃: SC306643
GSTA5 (untagged)-Human glutathione S-transferase alpha 5 (GSTA5)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_153699 edited
GAGACTGCTATCATGGCAGAGAAGCCCAAGCTCCACTACTCCAATGCACGGGGCAGTATG GAGTCCATTCGGTGGCTCCTGGCTGCAGCTGGAGTAGAGTTGGAAGAGAAATTTCTAGAA TCTGCAGAAGATTTGGACAAGTTAAGAAATGATGGGAGTTTGCTGTTCCAGCAAGTACCA ATGGTTGAGATTGACGGGATGAAGCTGGTGCAGACCAGAGCCATTCTTAACTACATTGCC AGCAAATACAACCTTTATGGGAAAGACATGAAGGAGAGAGCCCTGATTGATATGTACACA GAAGGTATAGTAGATTTGACTGAAATGATCCTTCTTCTGCTCATATGTCAACCAGAGGAA AGAGATGCCAAGACTGCCTTGGTCAAAGAGAAAATAAAAAATCGCTACTTCCCTGCCTTT GAAAAAGTCTTAAAGAGCCACAGACAAGACTACCTTGTTGGCAACAAGCTGAGCTGGGCT GACATTCACCTGGTGGAACTTTTCTACTACGTGGAAGAGCTTGACTCGAGTCTTATCTCC AGCTTCCCTCTGCTGAAGGCCCTGAAAACCAGAATCAGCAACCTGCCCACGGTGAAGAAG TTTCTGCAGCCTGGCAGCCAGAGAAAGCCTCCCATGGATGAGAAATCTTTAGAAGAAGCA AGGAAGATTTTCAGGTTTTAA |
| Restriction Sites | Please inquire |
| ACCN | NM_153699 |
| Insert Size | 700 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | ORF was fully sequenced and the DNA sequence matches with that of NM_153699.1.MG2606_G03 and G07 are also correct. Pool 10 ug of DNA and ship it to the customer. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_153699.1, NP_714543.1 |
| RefSeq Size | 845 bp |
| RefSeq ORF | 669 bp |
| Locus ID | 221357 |
| UniProt ID | Q7RTV2 |
| Protein Pathways | Drug metabolism - cytochrome P450, Glutathione metabolism, Metabolism of xenobiotics by cytochrome P450 |
| Gene Summary | The glutathione S-transferases (GST; EC 2.5.1.18) catalyze the conjugation of reduced glutathiones and a variety of electrophiles, including many known carcinogens and mutagens. The cytosolic GSTs belong to a large superfamily, with members located on different chromosomes. For additional information on GSTs, see GSTA1 (MIM 138359).[supplied by OMIM, Sep 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC215990 | GSTA5 (Myc-DDK-tagged)-Human glutathione S-transferase alpha 5 (GSTA5) |
CNY 2,400.00 |
|
| RC215990L1 | Lenti ORF clone of Human glutathione S-transferase alpha 5 (GSTA5), Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC215990L2 | Lenti ORF clone of Human glutathione S-transferase alpha 5 (GSTA5), mGFP tagged |
CNY 5,890.00 |
|
| RC215990L3 | Lenti ORF clone of Human glutathione S-transferase alpha 5 (GSTA5), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC215990L4 | Lenti ORF clone of Human glutathione S-transferase alpha 5 (GSTA5), mGFP tagged |
CNY 5,890.00 |
|
| RG215990 | GSTA5 (tGFP-tagged) - Human glutathione S-transferase alpha 5 (GSTA5) |
CNY 4,000.00 |
