United States
Germany
Japan
United Kingdom
China
BAFF Receptor (TNFRSF13C) (NM_052945) Human Untagged Clone
CAT＃: SC305701
TNFRSF13C (untagged)-Human tumor necrosis factor receptor superfamily, member 13C (TNFRSF13C)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BAFF-R; BAFFR; BROMIX; CD268; CVID4; prolixin |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_052945 edited
ATGAGGCGAGGGCCCCGGAGCCTGCGGGGCAGGGACGCGCCAGCCCCCACGCCCTGCGTC CCGGCCGAGTGCTTCGACCTGCTGGTCCGCCACTGCGTGGCCTGCGGGCTCCTGCGCACG CCGCGGCCGAAACCGGCCGGGGCCAGCAGCCCTGCGCCCAGGACGGCGCTGCAGCCGCAG GAGTCGGTGGGCGCGGGGGCCGGCGAGGCGGCGCTGCCCCTGCCCGGGCTGCTCTTTGGC GCCCCCGCGCTGCTGGGCCTGGCACTGGTCCTGGCGCTGGTCCTGGTGGGTCTGGTGAGC TGGAGGCGGCGACAGCGGCGGCTTCGCGGCGCGTCCTCCGCAGAGGCCCCCGACGGAGAC AAGGACGCCCCAGAGCCCCTGGACAAGGTCATCATTCTGTCTCCGGGAATCTCTGATGCC ACAGCTCCTGCCTGGCCTCCTCCTGGGGAAGACCCAGGAACCACCCCACCTGGCCACAGT GTCCCTGTGCCAGCCACAGAGCTGGGCTCCACTGAACTGGTGACCACCAAGACGGCCGGC CCTGAGCAACAATAG |
| Restriction Sites | Please inquire |
| ACCN | NM_052945 |
| Insert Size | 600 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_052945.2, NP_443177.1 |
| RefSeq Size | 898 bp |
| RefSeq ORF | 555 bp |
| Locus ID | 115650 |
| UniProt ID | Q96RJ3 |
| Protein Families | Druggable Genome, Transmembrane |
| Protein Pathways | Cytokine-cytokine receptor interaction, Primary immunodeficiency |
| Gene Summary | B cell-activating factor (BAFF) enhances B-cell survival in vitro and is a regulator of the peripheral B-cell population. Overexpression of Baff in mice results in mature B-cell hyperplasia and symptoms of systemic lupus erythematosus (SLE). Also, some SLE patients have increased levels of BAFF in serum. Therefore, it has been proposed that abnormally high levels of BAFF may contribute to the pathogenesis of autoimmune diseases by enhancing the survival of autoreactive B cells. The protein encoded by this gene is a receptor for BAFF and is a type III transmembrane protein containing a single extracellular cysteine-rich domain. It is thought that this receptor is the principal receptor required for BAFF-mediated mature B-cell survival. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC211270 | TNFRSF13C (Myc-DDK-tagged)-Human tumor necrosis factor receptor superfamily, member 13C (TNFRSF13C) |
CNY 2,400.00 |
|
| RC211270L1 | Lenti ORF clone of Human tumor necrosis factor receptor superfamily, member 13C (TNFRSF13C), Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC211270L2 | Lenti ORF clone of Human tumor necrosis factor receptor superfamily, member 13C (TNFRSF13C), mGFP tagged |
CNY 5,890.00 |
|
| RC211270L3 | Lenti ORF clone of Human tumor necrosis factor receptor superfamily, member 13C (TNFRSF13C), Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC211270L4 | Lenti ORF clone of Human tumor necrosis factor receptor superfamily, member 13C (TNFRSF13C), mGFP tagged |
CNY 4,800.00 |
|
| RG211270 | TNFRSF13C (tGFP-tagged) - Human tumor necrosis factor receptor superfamily, member 13C (TNFRSF13C) |
CNY 4,000.00 |
其它BAFF Receptor产品
