PLA2G12B (NM_032562) Human Untagged Clone
CAT#: SC305474
PLA2G12B (untagged)-Human phospholipase A2, group XIIB (PLA2G12B)
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FKSG71; GXIIB; GXIIIsPLA2; PLA2G13; sPLA2-GXIIB |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC305474 representing NM_032562.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAGCTGGCCAGTGGCTTCTTGGTTTTGTGGCTCAGCCTTGGGGGTGGCCTGGCTCAGAGCGACACG AGCCCTGACACGGAGGAGTCCTATTCAGACTGGGGCCTTCGGCACCTCCGGGGAAGCTTTGAATCCGTC AATAGCTACTTCGATTCTTTTCTGGAGCTGCTGGGAGGGAAGAATGGAGTCTGTCAGTACAGGTGCCGA TATGGAAAGGCACCAATGCCCAGACCTGGCTACAAGCCCCAAGAGCCCAATGGCTGCGGCTCCTATTTC CTGGGTCTCAAGGTACCAGAAAGTATGGACTTGGGCATTCCAGCAATGACAAAGTGCTGCAACCAGCTG GATGTCTGTTATGACACTTGCGGTGCCAACAAATATCGCTGTGATGCAAAATTCCGATGGTGTCTCCAC TCGATCTGCTCTGACCTTAAGCGGAGTCTGGGCTTTGTCTCCAAAGTGGAAGCAGCCTGTGATTCCCTG GTTGACACTGTGTTCAACACCGTGTGGACCTTGGGCTGCCGCCCCTTTATGAATAGTCAGCGGGCAGCT TGCATCTGTGCAGAGGAGGAGAAGGAAGAGTTATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_032562 |
Insert Size | 588 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_032562.4 |
RefSeq Size | 1577 bp |
RefSeq ORF | 588 bp |
Locus ID | 84647 |
UniProt ID | Q9BX93 |
Protein Families | Secreted Protein |
Protein Pathways | alpha-Linolenic acid metabolism, Arachidonic acid metabolism, Ether lipid metabolism, Fc epsilon RI signaling pathway, Glycerophospholipid metabolism, GnRH signaling pathway, Linoleic acid metabolism, Long-term depression, MAPK signaling pathway, Metabolic pathways, Vascular smooth muscle contraction, VEGF signaling pathway |
MW | 21.7 kDa |
Gene Summary | The protein encoded by this gene belongs to the phospholipase A2 (PLA2) group of enzymes, which function in glycolipid hydrolysis with the release of free fatty acids and lysophospholipids. This family member has altered phospholipid-binding properties and is catalytically inactive. The protein is secreted, and together with microsomal triglyceride transfer protein, it functions to regulate HNF4alpha-induced hepatitis C virus infectivity. The expression of this gene is down-regulated in various tumors, suggesting that it may function as a negative regulator of tumor progression. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2015] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210905 | PLA2G12B (Myc-DDK-tagged)-Human phospholipase A2, group XIIB (PLA2G12B) |
CNY 2,400.00 |
|
RC210905L1 | Lenti ORF clone of Human phospholipase A2, group XIIB (PLA2G12B), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC210905L2 | Lenti ORF clone of Human phospholipase A2, group XIIB (PLA2G12B), mGFP tagged |
CNY 5,890.00 |
|
RC210905L3 | Lenti ORF clone of Human phospholipase A2, group XIIB (PLA2G12B), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC210905L4 | Lenti ORF clone of Human phospholipase A2, group XIIB (PLA2G12B), mGFP tagged |
CNY 5,890.00 |
|
RG210905 | PLA2G12B (tGFP-tagged) - Human phospholipase A2, group XIIB (PLA2G12B) |
CNY 4,000.00 |
其它PLA2G12B产品