Argininosuccinate Lyase (ASL) (NM_001024946) Human Untagged Clone

CAT#: SC302323

ASL (untagged)-Human argininosuccinate lyase (ASL), transcript variant 4



  "NM_001024946" in other vectors (4)

CNY 5,488.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
ASL mouse monoclonal antibody, clone OTI3D4 (formerly 3D4)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ASAL
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001024946 edited
ATGGCCTCGGAGAGTGGGAAGCTTTGGGGTGGCCGGTTTGTGGGTGCAGTGGACCCCATC
ATGGAGAAGTTCAACGCGTCCATTGCCTACGACCGGCACCTTTGGGAGGTGGATGTTCAA
GGCAGCAAAGCCTACAGCAGGGGCCTGGAGAAGGCAGGGCTCCTCACCAAGGCCGAGATG
GACCAGATACTCCATGGCCTAGACAAGGTGGCTGAGGAGTGGGCCCAGGGCACCTTCAAA
CTGAACTCCAATGATGAGGACATCCACACAGCCAATGAGCGCCGCCTGAAGGAGCTCATT
GGTGCAACGGCAGGGAAGCTGCACACGGGACGGAGCCGGAATGACCAGGTGGTCACAGAC
CTCAGGCTGTGGATGCGGCAGACCTGCTCCACGCTCTCGGGCCTCCTCTGGGAGCTCATT
AGGACCATGGTGGATCGGGCAGAGGCGGAACGTGATGTTCTCTTCCCGGGGTACACCCAT
TTGCAGAGGGCCCAGCCCATCCGCTGGAGCCACTGGATTCTGAGTGGGGCCATTGCAGGC
AATCCCCTGGGTGTGGACCGAGAGCTGCTCCGAGCAGAACTCAACTTTGGGGCCATCACT
CTCAACAGCATGGATGCCACTAGTGAGCGGGACTTTGTGGCCGAGTTCCTGTTCTGGGCT
TCGCTGTGCATGACCCATCTCAGCAGGATGGCCGAGGACCTCATCCTCTACTGCACCAAG
GAATTCAGCTTCGTGCAGCTCTCAGATGCCTACAGCACGGGAAGCAGCCTGATGCCCCAG
AAGAAAAACCCCGACAGTTTGGAGCTGATCCGGAGCAAGGCTGGGCGTGTGTTTGGGCGG
TGTGCCGGGCTCCTGATGACCCTCAAGGGACTTCCCAGCACCTACAACAAAGACTTACAG
GAGGACAAGGAAGCTGTGTTTGAAGTGTCAGACACTATGAGTGCCGTGCTCCAGGTGGCC
ACTGGCGTCATCTCTACGCTGCAGATTCACCAAGAGAACATGGGACAGGCTCTCAGCCCC
GACATGCTGGCCACTGACCTTGCCTATTACCTGGTCCGCAAAGGGATGCCATTCCGCCAG
GCCCACGAGGCCTCCGGGAAAGCTGTGTTCATGGCCGAGACCAAGGGGGTCGCCCTCAAC
CAGCTGTCACTGCAGGAGCTGCAGACCATCAGCCCCCTGTTCTCGGGCGACGTGATCTGC
GTGTGGGACTACGGGCACAGTGTGGAGCAGTATGGTGCCCTGGGCGGCACTGCGCGCTCC
AGCGTCGACTGGCAGATCCGCCAGGTGCGGGCGCTACTGCAGGCACAGCAGGCCTAG
Restriction Sites Please inquire     
ACCN NM_001024946
Insert Size 1500 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001024946.1, NP_001020117.1
RefSeq Size 1983 bp
RefSeq ORF 1317 bp
Locus ID 435
Protein Pathways Alanine, aspartate and glutamate metabolism, Arginine and proline metabolism, Metabolic pathways
Gene Summary This gene encodes a member of the lyase 1 family. The encoded protein forms a cytosolic homotetramer and primarily catalyzes the reversible hydrolytic cleavage of argininosuccinate into arginine and fumarate, an essential step in the liver in detoxifying ammonia via the urea cycle. Mutations in this gene result in the autosomal recessive disorder argininosuccinic aciduria, or argininosuccinic acid lyase deficiency. A nontranscribed pseudogene is also located on the long arm of chromosome 22. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (4) lacks an alternate, in-frame exon, compared to variant 1, resulting in a shorter protein (isoform 3).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...