MAGEA4 (NM_001011548) Human Untagged Clone

CAT#: SC301576

MAGEA4 (untagged)-Human melanoma antigen family A, 4 (MAGEA4), transcript variant 1



  "NM_001011548" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
MAGEA4 mouse monoclonal antibody, clone OTI1F9 (formerly 1F9)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CT1.4; MAGE-41; MAGE-X2; MAGE4; MAGE4A; MAGE4B
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001011548, the custom clone sequence may differ by one or more nucleotides
ATGTCTTCTGAGCAGAAGAGTCAGCACTGCAAGCCTGAGGAAGGCGTTGAGGCCCAAGAA
GAGGCCCTGGGCCTGGTGGGTGCACAGGCTCCTACTACTGAGGAGCAGGAGGCTGCTGTC
TCCTCCTCCTCTCCTCTGGTCCCTGGCACCCTGGAGGAAGTGCCTGCTGCTGAGTCAGCA
GGTCCTCCCCAGAGTCCTCAGGGAGCCTCTGCCTTACCCACTACCATCAGCTTCACTTGC
TGGAGGCAACCCAATGAGGGTTCCAGCAGCCAAGAAGAGGAGGGGCCAAGCACCTCGCCT
GACGCAGAGTCCTTGTTCCGAGAAGCACTCAGTAACAAGGTGGATGAGTTGGCTCATTTT
CTGCTCCGCAAGTATCGAGCCAAGGAGCTGGTCACAAAGGCAGAAATGCTGGAGAGAGTC
ATCAAAAATTACAAGCGCTGCTTTCCTGTGATCTTCGGCAAAGCCTCCGAGTCCCTGAAG
ATGATCTTTGGCATTGACGTGAAGGAAGTGGACCCCGCCAGCAACACCTACACCCTTGTC
ACCTGCCTGGGCCTTTCCTATGATGGCCTGCTGGGTAATAATCAGATCTTTCCCAAGACA
GGCCTTCTGATAATCGTCCTGGGCACAATTGCAATGGAGGGCGACAGCGCCTCTGAGGAG
GAAATCTGGGAGGAGCTGGGTGTGATGGGGGTGTATGATGGGAGGGAGCACACTGTCTAT
GGGGAGCCCAGGAAACTGCTCACCCAAGATTGGGTGCAGGAAAACTACCTGGAGTACCGG
CAGGTACCCGGCAGTAATCCTGCGCGCTATGAGTTCCTGTGGGGTCCAAGGGCTCTGGCT
GAAACCAGCTATGTGAAAGTCCTGGAGCATGTGGTCAGGGTCAATGCAAGAGTTCGCATT
GCCTACCCATCCCTGCGTGAAGCAGCTTTGTTAGAGGAGGAAGAGGGAGTCTGA
Restriction Sites Please inquire     
ACCN NM_001011548
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001011548.1, NP_001011548.1
RefSeq Size 1724 bp
RefSeq ORF 954 bp
Locus ID 4103
UniProt ID P43358
Gene Summary This gene is a member of the MAGEA gene family. The members of this family encode proteins with 50 to 80% sequence identity to each other. The promoters and first exons of the MAGEA genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. The MAGEA genes are clustered at chromosomal location Xq28. They have been implicated in some hereditary disorders, such as dyskeratosis congenita. Several variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2020]
Transcript Variant: This variant (1) has the 5'-most exon compared to variants 2-4. All four variants encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...