United States
Germany
Japan
United Kingdom
China
PDE4DIP (NM_001002810) Human Untagged Clone
CAT＃: SC300450
PDE4DIP (untagged)-Human phosphodiesterase 4D interacting protein (PDE4DIP), transcript variant 4
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CMYA2; MMGL |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001002810, the custom clone sequence may differ by one or more nucleotides
ATGTCTAATGGATATCGCACTCTGTCCCAGCACCTCAATGACCTGAAGAAGGAGAACTTC AGCCTCAAGCTGCGCATCTACTTCCTGGAGGAGCGCATGCAACAGAAGTATGAGGCCAGC CGGGAGGACATCTACAAGCGGAACATTGAGCTGAAGGTTGAAGTGGAGAGCTTGAAACGA GAACTCCAGGACAAGAAACAGCATCTGGATAAAACATGGGCTGATGTGGAGAATCTCAAC AGTCAGAATGAAGCTGAGCTCCGACGCCAGTTTGAGGAGCGACAGCAGGAGACGGAGCAT GTTTATGAGCTCTTGGAGAATAAGATCCAGCTTCTGCAGGAGGAATCCAGGCTAGCAAAG AATGAAGCTGCGCGGATGGCAGCTCTGGTGGAAGCAGAGAAGGAGTGTAACCTGGAGCTC TCAGAGAAACTGAAGGGAGTCACCAAAAACTGGGAAGATGTACCAGGAGACCAGGTCAAG CCCGACCAATACACTGAGGCCCTGGCCCAGAGGGACAAGTAG |
| Restriction Sites | Please inquire |
| ACCN | NM_001002810 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001002810.1, NP_001002810.1 |
| RefSeq Size | 1250 bp |
| RefSeq ORF | 522 bp |
| Locus ID | 9659 |
| UniProt ID | Q5VU43 |
| Gene Summary | The protein encoded by this gene serves to anchor phosphodiesterase 4D to the Golgi/centrosome region of the cell. Defects in this gene may be a cause of myeloproliferative disorder (MBD) associated with eosinophilia. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2010] Transcript Variant: This variant (4) lacks multiple 3' exons but has an alternate 3' sequence compared to variant 1. The resulting isoform (4) is C-terminal truncated compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC213961 | PDE4DIP (Myc-DDK-tagged)-Human phosphodiesterase 4D interacting protein (PDE4DIP), transcript variant 4 |
CNY 3,990.00 |
|
| RC213961L3 | Lenti-ORF clone of PDE4DIP (Myc-DDK-tagged)-Human phosphodiesterase 4D interacting protein (PDE4DIP), transcript variant 4 |
CNY 5,890.00 |
|
| RC213961L4 | Lenti-ORF clone of PDE4DIP (mGFP-tagged)-Human phosphodiesterase 4D interacting protein (PDE4DIP), transcript variant 4 |
CNY 5,890.00 |
|
| RG213961 | PDE4DIP (tGFP-tagged) - Human phosphodiesterase 4D interacting protein (PDE4DIP), transcript variant 4 |
CNY 4,370.00 |
其它PDE4DIP产品
