Parathyroid Hormone (PTH) (NM_000315) Human Untagged Clone
CAT#: SC300045
PTH (untagged)-Human parathyroid hormone (PTH)
CNY 1,200.00
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FIH1; PTH1 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_000315 edited
GGGGTCTGCAGTCCAATTCATCAGTTGTCTTTAGTTTACTCAGCATCAGCTACTAACATA CCTGAACGAAGATCTTGTTCTAAGACATTGTATGTGAAGATGATACCTGCAAAAGACATG GCTAAAGTTATGATTGTCATGTTGGCAATTTGTTTTCTTACAAAATCGGATGGGAAATCT GTTAAGAAGAGATCTGTGAGTGAAATACAGCTTATGCATAACCTGGGAAAACATCTGAAC TCGATGGAGAGAGTAGAATGGCTGCGTAAGAAGCTGCAGGATGTGCACAATTTTGTTGCC CTTGGAGCTCCTCTAGCTCCCAGAGATGCTGGTTCCCAGAGGCCCCGAAAAAAGGAAGAC AATGTCTTGGTTGAGAGCCATGAAAAAAGTCTTGGAGAGGCAGACAAAGCTGATGTGAAT GTATTAACTAAAGCTAAATCCCAGTGAAAATGAAAACAGATATTGTCAGAGTTCTGCTCT AGACAGTGTAGGGCAACAATACATGCTGC |
Restriction Sites | Please inquire |
ACCN | NM_000315 |
Insert Size | 500 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_000315.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_000315.2, NP_000306.1 |
RefSeq Size | 828 bp |
RefSeq ORF | 348 bp |
Locus ID | 5741 |
UniProt ID | P01270 |
Protein Families | Druggable Genome, Secreted Protein |
Gene Summary | This gene encodes a member of the parathyroid family of proteins. The encoded preproprotein is proteolytically processed to generate a protein that binds to the parathyroid hormone/parathyroid hormone-related peptide receptor and regulates blood calcium and phosphate levels. Excess production of the encoded protein, known as hyperparathyroidism, can result in hypercalcemia and kidney stones. On the other hand, defective processing of the encoded protein may lead to hypoparathyroidism, which can result in hypocalcemia and numbness. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015] Transcript Variant: This variant (1) represents the shorter transcript and encodes the shorter isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219848 | PTH (Myc-DDK-tagged)-Human parathyroid hormone (PTH) |
CNY 1,200.00 |
|
RC219848L1 | Lenti ORF clone of Human parathyroid hormone (PTH), Myc-DDK-tagged |
CNY 3,600.00 |
|
RC219848L2 | Lenti ORF clone of Human parathyroid hormone (PTH), mGFP tagged |
CNY 5,890.00 |
|
RC219848L3 | Lenti ORF clone of Human parathyroid hormone (PTH), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC219848L4 | Lenti ORF clone of Human parathyroid hormone (PTH), mGFP tagged |
CNY 5,890.00 |
|
RG219848 | PTH (tGFP-tagged) - Human parathyroid hormone (PTH) |
CNY 4,370.00 |
其它Parathyroid Hormone产品