Parathyroid Hormone (PTH) (NM_000315) Human Untagged Clone

CAT#: SC300045

PTH (untagged)-Human parathyroid hormone (PTH)



  "NM_000315" in other vectors (6)

CNY 1,200.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


PTH mouse monoclonal antibody,clone OTI2D3
    • 100 ul

CNY 1,999.00
CNY 2,700.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FIH1; PTH1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_000315 edited
GGGGTCTGCAGTCCAATTCATCAGTTGTCTTTAGTTTACTCAGCATCAGCTACTAACATA
CCTGAACGAAGATCTTGTTCTAAGACATTGTATGTGAAGATGATACCTGCAAAAGACATG
GCTAAAGTTATGATTGTCATGTTGGCAATTTGTTTTCTTACAAAATCGGATGGGAAATCT
GTTAAGAAGAGATCTGTGAGTGAAATACAGCTTATGCATAACCTGGGAAAACATCTGAAC
TCGATGGAGAGAGTAGAATGGCTGCGTAAGAAGCTGCAGGATGTGCACAATTTTGTTGCC
CTTGGAGCTCCTCTAGCTCCCAGAGATGCTGGTTCCCAGAGGCCCCGAAAAAAGGAAGAC
AATGTCTTGGTTGAGAGCCATGAAAAAAGTCTTGGAGAGGCAGACAAAGCTGATGTGAAT
GTATTAACTAAAGCTAAATCCCAGTGAAAATGAAAACAGATATTGTCAGAGTTCTGCTCT
AGACAGTGTAGGGCAACAATACATGCTGC
Restriction Sites Please inquire     
ACCN NM_000315
Insert Size 500 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_000315.2.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_000315.2, NP_000306.1
RefSeq Size 828 bp
RefSeq ORF 348 bp
Locus ID 5741
UniProt ID P01270
Protein Families Druggable Genome, Secreted Protein
Gene Summary This gene encodes a member of the parathyroid family of proteins. The encoded preproprotein is proteolytically processed to generate a protein that binds to the parathyroid hormone/parathyroid hormone-related peptide receptor and regulates blood calcium and phosphate levels. Excess production of the encoded protein, known as hyperparathyroidism, can result in hypercalcemia and kidney stones. On the other hand, defective processing of the encoded protein may lead to hypoparathyroidism, which can result in hypocalcemia and numbness. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
Transcript Variant: This variant (1) represents the shorter transcript and encodes the shorter isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...