Sigma1 receptor (SIGMAR1) (NM_147157) Human Untagged Clone

CAT#: SC100278

SIGMAR1 (untagged)-Human sigma non-opioid intracellular receptor 1 (SIGMAR1), transcript variant 2



  "NM_147157" in other vectors (4)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Antibody against OPRS1 (N-term)
    • 400 ul

CNY 6,314.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ALS16; DSMA2; hSigmaR1; OPRS1; SIG-1R; sigma1R; SR-BP; SR-BP1; SRBP
Vector pCMV6-XL6
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_147157 edited
ATGCAGTGGGCCGTGGGCCGGCGGTGGGCGTGGGCCGCGCTGCTCCTGGCTGTCGCAGCG
GTGCTGACCCAGGTCGTCTGGCTCTGGCTGGGTACGCAGAGCTTCGTCTTCCAGCGCGAA
GAGATAGCGCAGTTGGCGCGGCAGTACGCTGGGCTGGACCACGAGCTGGCCTTCTCTCGT
CTGATCGTGGAGCTGCGGCGGCTGCACCCAGGCCACGTGCTGCCCGACGAGGAGCTGCAG
TGGGTGTTCGTGAATGCGGGTGGCTGGATGGGCGCCATGTGCCTTCTGCACGCCTCGCTG
TCCGAGTATGTGCTGCTCTTCGGCACCGCCTTGGGCTCCCGCGGCCACTCGGGGGAGACG
GTAGTACACGGGCCTGGTGAGGCAACAGCTGTGGAGTGGGGGCCAAACACATGGATGGTG
GAGTACGGCCGGGGCGTCATCCCATCCACCCTGGCCTTCGCGCTGGCCGACACTGTCTTC
AGCACCCAGGACTTCCTCACCCTCTTCTATACTCTTCGCTCCTATGCTCGGGGCCTCCGG
CTTGAGCTCACCACCTACCTCTTTGGCCAGGACCCTTGA
Restriction Sites Please inquire     
ACCN NM_147157
Insert Size 1900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_147157.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_147157.1, NP_671513.1
RefSeq Size 1580 bp
RefSeq ORF 579 bp
Locus ID 10280
UniProt ID Q99720
Domains ERG2_Sigma1R
Protein Families Druggable Genome, GPCR, Transmembrane
Gene Summary This gene encodes a receptor protein that interacts with a variety of psychotomimetic drugs, including cocaine and amphetamines. The receptor is believed to play an important role in the cellular functions of various tissues associated with the endocrine, immune, and nervous systems. As indicated by its previous name, opioid receptor sigma 1 (OPRS1), the product of this gene was erroneously thought to function as an opioid receptor; it is now thought to be a non-opioid receptor. Mutations in this gene has been associated with juvenile amyotrophic lateral sclerosis 16. Alternative splicing of this gene results in transcript variants encoding distinct isoforms. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (2) lacks an in-frame exon in the central coding region, compared to variant 1. The encoded isoform (2) is shorter, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...