Sap30l (NM_001081168) Mouse Tagged ORF Clone
CAT#: MR223131
- TrueORF®
Sap30l (Myc-DDK-tagged) - Mouse SAP30-like (Sap30l)
ORF Plasmid: tGFP
"NM_001081168" in other vectors (4)
Need custom modification / cloning service?
Get a free quote
CNY 2,400.00
CNY 3,810.00
CNY 300.00
Specifications
Product Data | |
Type | Mouse Tagged ORF Clone |
Tag | Myc-DDK |
Synonyms | 2310079P12Rik; AF006998; L55 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MR223131 representing NM_001081168
Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGAACGGCTTCAGCACAGAGGAGGACAGCCGCGAAGGGCCCCCTGCCGCCCCCGCCGCCGCCCCGGGCT ACGGCCAGAGCTGCTGCCTCATCGCGGACGGCGAGCGCTGCGTCCGGCCCGCGGGCAACGCCTCCTTCAG CAAGAGGGTGCAGAAAAGCATCTCGCAGAAGAAACTCAAGCTGGACATAGACAAGAGCGTAAGGCACCTG TATATCTGCGACTTCCACAAAAATTTCATCCAGAGCGTCCGAAATAAAAGGAAGAGGAAGGCAAGTGACG ATGGCGGAGACTCCCCCGAGCACGATGCCGACATCCCTGAGGTTGATCTGTTCCAGCTGCAGGTGAACAC GCTCCGACGTTACAAACGGCACTATAAGCTGCAGACCAGACCAGGCTTCAACAAGGCCCAGCTAGCAGAG ACTGTGAGCCGACACTTCAGGAACATACCAGTGAATGAGAAAGAGACGCTTGCCTATTTCATCTACATGG TGAAGAGTAACAGGAGCAGACTGGACCAGAAGTCAGAGGGCAGCAAGCAGCTTGAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Chromatograms |
CHROMATOGRAMS
Sequencher program is needed, download here. |
Restriction Sites | SgfI-MluI Cloning Scheme for this gene Plasmid Map |
ACCN | NM_001081168 |
ORF Size | 546 bp |
OTI Disclaimer | The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001081168.1, NP_001074637.1 |
RefSeq Size | 1549 bp |
RefSeq ORF | 549 bp |
Locus ID | 50724 |
UniProt ID | Q5SQF8 |
MW | 21.2 kDa |
Gene Summary | Functions as transcription repressor, probably via its interaction with histone deacetylase complexes. Involved in the functional recruitment of the class 1 Sin3-histone deacetylase complex (HDAC) to the nucleolus. Binds DNA, apparently without sequence-specificity, and bends bound double-stranded DNA. Binds phosphoinositol phosphates (phosphoinositol 3-phosphate, phosphoinositol 4-phosphate and phosphoinositol 5-phosphate) via the same basic sequence motif that mediates DNA binding and nuclear import.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MC209861 | Sap30l (untagged) - Mouse SAP30-like (Sap30l), (10ug) |
CNY 3,990.00 |
|
MG223131 | Sap30l (tGFP-tagged) - Mouse SAP30-like (Sap30l), (10ug) |
CNY 2,850.00 |
|
MR223131L3 | Lenti ORF clone of Sap30l (Myc-DDK-tagged) - Mouse SAP30-like (Sap30l) |
CNY 4,750.00 |
|
MR223131L4 | Lenti ORF clone of Sap30l (mGFP-tagged) - Mouse SAP30-like (Sap30l) |
CNY 4,750.00 |