Ctla4 (NM_001281976) Mouse Untagged Clone

CAT#: MC226075

Ctla4 (untagged) - Mouse cytotoxic T-lymphocyte-associated protein 4 (Ctla4), transcript variant 2



  "NM_001281976" in other vectors (1)

CNY 2,000.00


货期*
3周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (4)
Recombinant Anti-CTLA-4 (Clone 9H10)
    • 200 ug

CNY 6,881.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Cd152; Ctla; Ctla-4; Ly-5; Ly-56
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC226075 representing NM_001281976
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTTGTCTTGGACTCCGGAGGTACAAAGCTCAACTGCAGCTGCCTTCTAGGACTTGGCCTTTTGTAG
CCCTGCTCACTCTTCTTTTCATCCCAGTCTTCTCTGAAGCCATACAGGTGACCCAACCTTCAGTGGTGTT
GGCTAGCAGCCATGGTGTCGCCAGCTTTCCATGTGAATATTCACCATCACACAACACTGATGAGGTCCGG
GTGACTGTGCTGCGGCAGACAAATGACCAAATGACTGAGGTCTGTGCCACGACATTCACAGAGAAGAATA
CAGTGGGCTTCCTAGATTACCCCTTCTGCAGTGGTACCTTTAATGAAAGCAGAGTGAACCTCACCATCCA
AGGACTGAGAGCTGTTGACACGGGACTGTACCTCTGCAAGGTGGAACTCATGTACCCACCGCCATACTTT
GTGGGCATGGGCAACGGGACGCAGATTTATGTCATTGCTAAAGAAAAGAAGTCCTCTTACAACAGGGGTC
TATGTGAAAATGCCCCCAACAGAGCCAGAATGTGA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001281976
Insert Size 525 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation Clone contains native stop codon, and expresses the complete ORF without any c-terminal tag.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001281976.1, NP_001268905.1
RefSeq Size 1823 bp
RefSeq ORF 525 bp
Locus ID 12477
Gene Summary This gene is a member of the immunoglobulin superfamily, and encodes a protein that functions as a negative regulator of T-cell responses. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2013]
Transcript Variant: This variant (2) lacks the penultimate coding exon, which results in a frame-shift and early translation termination compared to variant 1. The resulting shorter isoform (2, also known as sCTLA-4) with a distinct C-terminus, lacks the transmembrane domain and is secreted (PMIDs: 10831323, 23400950).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Other Versions

Customer Reviews 
Loading...