Hnrnpc (NM_001170984) Mouse Untagged Clone

CAT#: MC217708

Hnrnpc (untagged) - Mouse heterogeneous nuclear ribonucleoprotein C (Hnrnpc), transcript variant 5, (10ug)



  "NM_001170984" in other vectors (3)

CNY 6,940.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Hnrnpc Antibody - C-terminal region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AL022939; D14Wsu171e; hnrnp-C; hnRNPC1; hnRNPC2; Hnrpc; Hnrpc1; Hnrpc2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC217708 representing NM_001170984
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGGCTAGCAATGTTACCAACAAGACAGATCCTCGGTCCATGAATTCCCGTGTATTCATTGGGAATCTCA
ACACTCTGGTGGTCAAGAAGTCTGATGTGGAGGCCATCTTTTCAAAGTATGGCAAAATTGTGGGCTGCTC
TGTGCATAAAGGCTTTGCCTTTGTCCAGTATGTTAATGAAAGAAATGCCCGAGCTGCTGTAGCTGGCGAG
GATGGCAGAATGATTGCTGGCCAGGTTTTAGATATTAACCTGGCTGCAGAGCCAAAAGTGAACCGAGGAA
AAGCAGGTGTGAAACGATCTGCAGCGGAGATGTACGGTTCCTCATTTGACTTGGACTATGACTTTCAACG
GGATTATTATGACAGGATGTACAGTTACCCAGCGCGGGTTCCTCCTCCTCCTCCTATTGCTCGAGCTGTG
GTGCCTTCCAAACGTCAGCGTGTTTCAGGGAACACCTCACGAAGGGGCAAAAGTGGATTCAATTCGAAGA
GTGGACAAAGGGGATCTTCTTCCAAGTCTGGAAAATTGAAAGGTGATGACCTTCAGGCCATTAAAAAGGA
GCTGACTCAGATAAAACAAAAAGTGGATTCTCTTCTGGAAAGCCTGGAAAAAATTGAAAAAGAACAAAGC
AAGCAAGCAGAGATGAAGAATGAAAAGTCTGAAGAAGAGCAGAGCAGCGCCTCTGTGAAGAAAGATGAGA
CTAATGTGAAGATGGAGTCTGAGGCAGGTGCAGATGACTCTGCTGAGGAGGGTGACCTGCTGGATGATGA
CGATAATGAAGATCGGGGGGATGACCAGCTGGAGTTGAAGGATGATGAAAAAGAGCCTGAGGAAGGAGAA
GACGACAGAGACAGCGCCAATGGGGAGGATGACTCTTAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_001170984
Insert Size 879 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001170984.1, NP_001164455.1
RefSeq Size 2781 bp
RefSeq ORF 879 bp
Locus ID 15381
UniProt ID Q9Z204
Gene Summary Binds pre-mRNA and nucleates the assembly of 40S hnRNP particles. Interacts with poly-U tracts in the 3' UTR or 5'-UTR of mRNA and modulates the stability and the level of translation of bound mRNA molecules. Single HNRNPC tetramers bind 230-240 nucleotides. Trimers of HNRNPC tetramers bind 700 nucleotides. May play a role in the early steps of spliceosome assembly and pre-mRNA splicing. N6-methyladenosine (m6A) has been shown to alter the local structure in mRNAs and long non-coding RNAs (lncRNAs) via a mechanism named 'm(6)A-switch', facilitating binding of HNRNPC, leading to regulation of mRNA splicing.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (5) uses two different splice sites in the coding region, compared to variant 1. The resulting protein (isoform 4) is shorter when it is compared to isoform 1. Variants 5, 17 and 18 encode the same isoform (4). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...