Vav3 (NM_146139) Mouse Untagged Clone

CAT#: MC210125

Vav3 (untagged) - Mouse vav 3 oncogene (Vav3), transcript variant 2, (10ug)



  "NM_146139" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms A530094I06Rik; AA986410; Idd18.1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>MC210125 representing NM_146139
Red=Cloning site Blue=ORF Orange=Stop codon

TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC
GCCGCGATCGCC

ATGCCAATTTTTACCTTTGTTTCAGAACAAGGGCCATTCAAACCACCAGAGAAACGGACCAATGGACTTC
GGAGAGCTTCCAGACAGGTGGACCCAGGTTTGCCGAAGATGCAGGTCATTAGGAACTACACTGGCACCCC
GGCCCCAGGGCTTCATGAAGGACCACCATTGCATATCCAGGCAGGCGACACTGTTGAACTTCTGAGAGGA
GATGCACACAGTGTGTTCTGGCAGGGACGAAACTTAGCTTCAGGAGAGGTTGGATTTTTCCCAAGTGATG
CTGTCAAACCCTCTCCATGTGTACCTAAACCAGTAGATTATTCTTGCCAACCCTGGTATGCTGGCCCAAT
GGAAAGATTGCAGGCAGAAACTGAACTTATTAACAGGGTGAATAGTACTTACCTTGTAAGGCACAGGACC
AAAGAATCTGGAGAATATGCAATTAGCATTAAGTACAATAATGAAGCAAAACACATCAAGATTTTAACAA
GAGATGGCTTTTTTCACATTGCAGAAAATAGAAAATTTAAAAGCTTAATGGAACTTGTGGAGTACTACAA
GCACCATTCTCTCAAAGAAGGGTTCAGGACCTTAGATACAACGCTACAGTTTCCATACAAGGAGCCAGAA
CAGCCAGCTGGACAGAGGGGTAATAGAACAGGCAACAGCTTGTTGAGTCCCAAAGTACTGGGTATTGCCA
TCGCTCGGTACGACTTCTGTGCAAGAGATATGCGGGAGCTCTCCCTATTGAAAGGAGACATGGTGAAGAT
TTACACGAAGATGAGTGCAAATGGCTGGTGGAGAGGTGAAGTAAATGGCAGGGTGGGCTGGTTTCCATCC
ACATATGTGGAAGAAGATGAATAA


ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT
ACAAGGATGACGACGATAAGGTTTAA
Restriction Sites SgfI-MluI     
ACCN NM_146139
Insert Size 864 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_146139.2, NP_666251.1
RefSeq Size 3061 bp
RefSeq ORF 864 bp
Locus ID 57257
UniProt ID Q9R0C8
Gene Summary Exchange factor for GTP-binding proteins RhoA, RhoG and, to a lesser extent, Rac1. Binds physically to the nucleotide-free states of those GTPases (By similarity). Plays an important role in angiogenesis. Its recruitment by phosphorylated EPHA2 is critical for EFNA1-induced RAC1 GTPase activation and vascular endothelial cell migration and assembly. May be important for integrin-mediated signaling, at least in some cell types. In osteoclasts, along with SYK tyrosine kinase, required for signaling through integrin alpha-v/beta-1 (ITAGV-ITGB1), a crucial event for osteoclast proper cytoskeleton organization and function. This signaling pathway involves RAC1, but not RHO, activation. Necessary for proper wound healing. In the course of wound healing, required for the phagocytotic cup formation preceding macrophage phagocytosis of apoptotic neutrophils. Responsible for integrin beta-2-mediated macrophage adhesion and, to a lesser extent, contributes to beta-3-mediated adhesion. Does not affect integrin beta-1-mediated adhesion.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...