United States
Germany
Japan
United Kingdom
China
Elane (NM_015779) Mouse Untagged Clone
CAT＃: MC209856
Elane (untagged) - Mouse elastase, neutrophil expressed (Elane), (10ug)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | El; Ela2; F430011M15Rik; N; NE |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_015779, the custom clone sequence may differ by one or more nucleotides
ATGGCCCTTGGCAGACTATCCAGCCGGACTCTGGCTGCCATGCTACTGGCATTGTTCCTGGGTGGCCCAG CACTGGCCTCAGAGATTGTTGGTGGCCGGCCGGCCCGGCCCCATGCTTGGCCCTTCATGGCATCCCTGCA GAGGCGTGGAGGTCATTTCTGTGGTGCCACCCTCATTGCCAGGAACTTCGTCATGTCAGCAGCCCACTGT GTGAACGGCCTAAATTTCCGGTCAGTGCAGGTAGTGCTGGGAGCCCATGACCTGCGGCGACAGGAGCGCA CTCGACAGACCTTCTCTGTGCAGCGGATCTTCGAGAATGGCTTTGACCCATCACAACTGCTGAACGACAT TGTGATTATCCAGCTCAATGGCTCCGCTACCATTAACGCCAACGTGCAGGTGGCCCAGCTGCCTGCCCAG GGCCAGGGCGTGGGTGACAGAACTCCATGTCTGGCCATGGGCTGGGGCAGGTTGGGCACAAACAGACCAT CACCCAGTGTGCTACAAGAGCTCAATGTGACAGTGGTGACTAACATGTGCCGCCGTCGTGTGAACGTATG CACTCTGGTGCCACGTCGGCAGGCAGGCATCTGCTTCGGGGACTCTGGCGGACCCTTGGTCTGTAACAAC CTTGTCCAAGGCATTGACTCCTTCATCCGAGGAGGCTGTGGATCTGGATTGTACCCAGATGCCTTCGCCC CTGTGGCTGAGTTTGCAGATTGGATCAATTCCATTATCCGAAGCCATAATGACCACCTTCTTACCCATCC CAAAGACCGAGAGGGCAGGACCAACTAG |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_015779 |
| Insert Size | 798 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | BC145800, AAI45801 |
| RefSeq Size | 905 bp |
| RefSeq ORF | 798 bp |
| Locus ID | 50701 |
| UniProt ID | Q3UP87 |
| Gene Summary | This gene encodes a member of the chymotrypsin-like family of serine protease enzymes that hydrolyzes a broad range of protein substrates including elastin. This gene is expressed by neutrophils where the encoded enzyme is stored in azurophil granules. Upon neutrophil activation, the active enzyme is released into the extracellular mileu. Mice lacking the encoded protein exhibit increased susceptibility to sepsis and death following intraperitoneal infection with Gram negative bacteria. This gene is located adjacent to a related proteinase gene on chromosome 10. [provided by RefSeq, Jul 2016] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG226046 | Elane (tGFP-tagged) - Mouse elastase neutrophil expressed (Elane), (10ug) |
CNY 2,850.00 |
|
| MR226046 | Elane (Myc-DDK-tagged) - Mouse elastase, neutrophil expressed (Elane) |
CNY 2,081.00 |
|
| MR226046L3 | Lenti ORF clone of Elane (Myc-DDK-tagged) - Mouse elastase, neutrophil expressed (Elane) |
CNY 4,750.00 |
|
| MR226046L4 | Lenti ORF clone of Elane (mGFP-tagged) - Mouse elastase, neutrophil expressed (Elane) |
CNY 4,800.00 |
