Csf2 (NM_009969) Mouse Untagged Clone
CAT#: MC208342
Csf2 (untagged) - Mouse colony stimulating factor 2 (granulocyte-macrophage) (Csf2), (10ug)
CNY 1,800.00
Cited in 3 publications. |
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | CSF; Csfgm; Gm-CSf; GMCSF; MGI-IGM |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>MC208342 representing NM_009969
Red=Cloning site Blue=ORF TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTGGCTGCAGAATTTACTTTTCCTGGGCATTGTGGTCTACAGCCTCTCAGCACCCACCCGCTCACCCA TCACTGTCACCCGGCCTTGGAAGCATGTAGAGGCCATCAAAGAAGCCCTGAACCTCCTGGATGACATGCC TGTCACATTGAATGAAGAGGTAGAAGTCGTCTCTAACGAGTTCTCCTTCAAGAAGCTAACATGTGTGCAG ACCCGCCTGAAGATATTCGAGCAGGGTCTACGGGGCAATTTCACCAAACTCAAGGGCGCCTTGAACATGA CAGCCAGCTACTACCAGACATACTGCCCCCCAACTCCGGAAACGGACTGTGAAACACAAGTTACCACCTA TGCGGATTTCATAGACAGCCTTAAAACCTTTCTGACTGATATCCCCTTTGAATGCAAAAAACCAGTCCAA AAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA |
Restriction Sites | SgfI-MluI |
ACCN | NM_009969 |
Insert Size | 426 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC116880, AAI16881 |
RefSeq Size | 618 bp |
RefSeq ORF | 426 bp |
Locus ID | 12981 |
UniProt ID | P01587 |
Gene Summary | Cytokine that stimulates the growth and differentiation of hematopoietic precursor cells from various lineages, including granulocytes, macrophages, eosinophils and erythrocytes.[UniProtKB/Swiss-Prot Function] |
Citations (3)
The use of this cDNA Clones has been cited in the following citations: |
---|
GM‐CSF is key in the efficacy of vaccine‐induced reduction of Helicobacter pylori infection
,null,
Helicobacter
,PubMed ID 35092634
[Csf2]
|
Broad-Spectrum Therapeutic Suppression of Metastatic Melanoma through Nuclear Hormone Receptor Activation
,Pencheva, N;Buss, CG;Posada, J;Merghoub, T;Tavazoie, SF;,
Cell
,PubMed ID 24581497
[CSF2]
|
Immune-Dependent and Independent Antitumor Activity of GM-CSF Aberrantly Expressed by Mouse and Human Colorectal Tumors
,Rocio G. Urdinguio, Agustin F. Fernandez, Angela Moncada-Pazos, Covadonga Huidobro, Ramon M. Rodriguez, Cecilia Ferrero, Pablo Martinez-Camblor, Alvaro J. Obaya, Teresa Bernal, Adolfo Parra-Blanco, Luis Rodrigo, Maria Santacana, Xavier Matias-Guiu, Beatriz Soldevilla, Gemma Dominguez, Felix Bonilla, Santiago Cal, Carlos Lopez-Otin, and Mario F. Fraga,
Cancer Res., Jan 2013; 73: 395 - 405.
[CSF2]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG222594 | Csf2 (tGFP-tagged) - Mouse colony stimulating factor 2 (granulocyte-macrophage) (Csf2), (10ug) |
CNY 3,400.00 |
|
MR222594 | Csf2 (Myc-DDK-tagged) - Mouse colony stimulating factor 2 (granulocyte-macrophage) (Csf2) |
CNY 1,800.00 |
|
MR222594L1 | Lenti ORF clone of Csf2 (Myc-DDK-tagged) - Mouse colony stimulating factor 2 (granulocyte-macrophage) (Csf2) |
CNY 5,890.00 |
|
MR222594L2 | Lenti ORF clone of Csf2 (mGFP-tagged) - Mouse colony stimulating factor 2 (granulocyte-macrophage) (Csf2) |
CNY 4,200.00 |
|
MR222594L3 | Lenti ORF clone of Csf2 (Myc-DDK-tagged) - Mouse colony stimulating factor 2 (granulocyte-macrophage) (Csf2) |
CNY 4,200.00 |
|
MR222594L4 | Lenti ORF clone of Csf2 (mGFP-tagged) - Mouse colony stimulating factor 2 (granulocyte-macrophage) (Csf2) |
CNY 4,200.00 |