Pcbd1 (NM_025273) Mouse Untagged Clone
CAT#: MC201813
Pcbd1 (untagged) - Mouse pterin 4 alpha carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 1 (Pcbd1), (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | Dcoh; Pcbd; Pcd; Phs |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC024354 sequence for NM_025273
GCTTCCCGCACTGGACATGGCCGGCAAGGCACACAGGCTGAGCGCCGAGGAGCGAGACCAGCTGCTGCCA AACCTGAGGGCTGTGGGGTGGAATGAAGTAGAAGGCCGAGATGCTATCTTCAAGCAGTTCCATTTTAAAG ACTTCAACAGGGCTTTTGGCTTCATGACAAGAGTAGCCCTGCAGGCTGAAAAGCTGGACCACCATCCCGA GTGGTTTAACGTGTACAACAAGGTCCATATCACCTTGAGCACCCATGAATGTGCCGGTCTTTCGGAACGG GATATAAACCTGGCCAGCTTCATCGAACAAGTCGCCGTGTCTATGACATAGATCTACCCTGACTCTTATT TGCTTGGGGGAAGGAGTGACTGGAGGAGGAACCTAGGAAGGGAACCAAGGAGGCTGGCCCTTGCTCCCTG ACTCTTTCAGTGACCACCACCTCCCTATGCAGAAGGGATGTCAATGTCAACAGCAGGGACTGAGACCTTT CTCTGTGCCACTCTCCTCACTGGGGCTCTGCCATGTTACACTAATTTGAATAAGCTCTCCCTTTTTCTGT AGAGTTCCCAGCCTCAGTAATGTTCCAGGCTGCTTCTTGTTCCTTTTCTACCCTTTCTAGTTCATTTTCC AAGGTAGCTGTGATAAAGCATGACATAAAAGCCCAATTCAGATCCTACTAATAAAACAAGCTCCAATGTA TTATGGAAACATGTGCTTTTACGCCTCCAATAAAACTATGTTATCGATAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_025273 |
Insert Size | 315 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC024354, AAH24354 |
RefSeq Size | 763 bp |
RefSeq ORF | 315 bp |
Locus ID | 13180 |
UniProt ID | P61458 |
Gene Summary | This gene encodes a member of the pterin-4-alpha-carbinolamine dehydratase family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein functions as both a dehydratase involved in tetrahydrobiopterin biosynthesis, and as a cofactor for HNF1A-dependent transcription. [provided by RefSeq, Apr 2015] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MC201814 | Pcbd1 (untagged) - Mouse pterin 4 alpha carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 1 (Pcbd1), (10ug) |
CNY 1,200.00 |
|
MG200344 | Pcbd1 (tGFP-tagged) - Mouse pterin 4 alpha carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 1 (Pcbd1) |
CNY 2,850.00 |
|
MR200344 | Pcbd1 (Myc-DDK-tagged) - Mouse pterin 4 alpha carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 1 (Pcbd1) |
CNY 1,200.00 |
|
MR200344L3 | Lenti ORF clone of Pcbd1 (Myc-DDK-tagged) - Mouse pterin 4 alpha carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 1 (Pcbd1) |
CNY 4,750.00 |
|
MR200344L4 | Lenti ORF clone of Pcbd1 (mGFP-tagged) - Mouse pterin 4 alpha carbinolamine dehydratase/dimerization cofactor of hepatocyte nuclear factor 1 alpha (TCF1) 1 (Pcbd1) |
CNY 4,750.00 |